জীব রসায়নজীববিজ্ঞানদৈনন্দিন বিজ্ঞান

করোনা ভাইরাসের জিনোম: খোলসবন্দি এক দুঃসংবাদের আখ্যান

“ভাইরাস হল প্রোটিনে বন্দি একটুকরো খারাপ সংবাদ” – এমনটাই ১৯৭৭ সালে বলেছিলেন জীববিজ্ঞানী জন (Jean) ও পিটার মেডাওয়ার (Peter Medawar)।

২০২০ এর জানুয়ারিতে বিজ্ঞানীরা সেরকম আরেকটি খারাপ সংবাদের অর্থোদ্ধার করেন। এর নাম সার্স কোভিড-২ ভাইরাস, যার ফলে বর্তমান সময়ে দেখা দিয়েছে একালের মহামারী কোভিড-১৯ (Covid-19)। অনেক দেশের বিজ্ঞানীরা ইতোমদ্ধ্যেই এই ভাইরাসের জিনোম সিকোয়েন্স করেছেন। ভাইরাসটির সর্বপ্রথম নমুনা পাওয়া যায় ৪১ বছর বয়সী এক লোকের শরীর থেকে যিনি ঊহানের সামুদ্রিক প্রাণী বিক্রির জন্য নির্ধারিত মার্কেটে কাজ করতেন। সেই ঊহানের সামুদ্রিক প্রাণীর বাজার থেকেই সর্বপ্রথম কোভিড-১৯ এর সংক্রমণ শুরু, যা বর্তমান বিশ্বে রূপ নিয়েছে ভয়ংকর ও প্রাণঘাতী মহামারীতে।

বিজ্ঞানীরা এখনও এই ভাইরাসের জিনোম নিয়ে বেশ নাজেহাল অবস্থায় আছেন। তারা চেষ্টা করছেন এর স্বরূপ একদম ভালোভাবে বোঝার। জিনোমের রহস্য সম্পূর্ণরূপে ভেদ করা গেলে এর বিরুদ্ধে তৈরি করা সম্ভব হবে কার্যকর ভ্যাক্সিন । এমনকি জানা যাবে কোন ওষুধে মুক্তি পাওয়া যাবে এই মরণঘাতী ভাইরাসের প্রকোপ থেকে।

একসুত্রক আরএনএ

ভাইরাসকে বেঁচে থাকতে হলে অবশ্যই একে কোনো না কোনো জীবন্ত কোষকে অবলম্বন করে বেঁচে থাকতে হবে। তাই যেকোনো ভাইরাসেরই সর্বপ্রথম কাজ হচ্ছে কোনো জীবীত কোষকে আক্রমণ করা। আক্রমণ করার পর ভাইরাসটি তার জেনেটিক বস্তু আক্রান্ত কোষের অভ্যন্তরে প্রবেশ করিয়ে দেয়। পরবর্তীতে ভাইরাসের জেনেটিক বস্তুটি নানা সূক্ষ্ম, আণবিক ও জটিল কোষীয় কার্যপদ্ধতির দ্বারা একই আকার ও ধরনের উত্তরোত্তর অনেকগুলো প্রতিলিপি তৈরি করে। পরবর্তীতে সেই প্রতিলিপিগুলো আক্রান্ত কোষ ভেদ করে বেরিয়ে ওই পোষকের অন্যান্য সজীব কোষকে ব্যাপকহারে আক্রমণ করা শুরু করে।

ভাইরাল আরএনএ

ভাইরাসের বেঁচে থাকার কোনো জীবীত কোষীয় পরিবেশ অপরিহার্য। এটি ছাড়া কোনো ভাইরাসই বংশবৃদ্ধি তো দূরে থাক, তার নিজের মধ্যে জীবনের কোনো লক্ষণই থাকে না। আমাদের বর্তমান দুনিয়ার খলনায়কেরও ঠিক একই অনাবশ্যক প্রয়োজনটি রয়েছে। করোনা ভাইরাস যখন কোনো কোষকে আক্রান্ত করে তখন সে তার সম্পূর্ণ আরএনএ সূত্রকটি উক্ত আক্রান্ত কোষে প্রবেশ করিয়ে দেয় শুধু, আর কিছুই না! 

করোনা ভাইরাসের এই আরএনএ –ই তার একমাত্র জেনেটিক বস্তু; এবং তা একসূত্রক। সম্পূর্ণ আরএনএ অণুর দৈর্ঘ্য ত্রিশ হাজার ক্ষারক; যেখানে মানব জিনোমের দৈর্ঘ্য প্রায় তিন বিলিয়ন ক্ষারক জোড়। জেনেটিক বস্তুতে একেকটি ক্ষারককে তার দৈর্ঘ্যের একক ধরা হয়ে থাকে। করোনা ভাইরাসের জিনোম একসূত্রক, মানুষের জেনেটিক বস্তুর মত দ্বিসূত্রক নয় বিধায় এর দৈর্ঘ্য ক্ষারক জোড় নয়। আরএনএ সর্বোপরি চারটি ক্ষারক দিয়ে গঠিত, যথা – অ্যাডিনিন (adenine), গুয়ানিন (guanine), সাইটোসিন (cytosine) এবং ইউরাসিল (uracil)।কিন্তু ডিএনএ –তে ইউরাসিলের বদলে থাকে থাইমিন (thymine)।

ডিএনএ এবং আরএনএ-র তুলনামূলক পার্থক্য

করোনা ভাইরাসের এই জিনোম সর্বমোট ২৯ টি প্রোটিন উৎপন্ন করে বলে বিজ্ঞানীরা এখন পর্যন্ত জানতে পেরেছেন। এই ২৯ টি (বা হয়তোবা আরও অনাবিষ্কৃত প্রোটিন) প্রোটিনই পোষক কোষের কোষীয় বস্তুকে কব্জা করে ভাইরাসের নিজস্ব অজস্র কপি তৈরি করে এবং সমস্ত পোষক দেহে ছড়িয়ে পড়ে। পরবর্তীতে এরা পোষক দেহের রোগ প্রতিরোধ ব্যবস্থা বা অনাক্রম্য ব্যবস্থাকে ক্রমে ক্রমে দুর্বল করে দিতে শুরু করে।

করোনা ভাইরাসের আরএনএ –র প্রথম সিকুয়েন্সটি ঐ চার অক্ষরের ক্ষারকে নিম্নরূপ:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

পোষক দেহের প্রোটিন তৈরির কোষীয় সরঞ্জাম ব্যবহার করে উপরোক্ত সিকুয়েন্সটির কোডিংয়ের মাধ্যমেই শুরু হয় করোনা ভাইরাসের নিজস্ব কপি তৈরির প্রক্রিয়া এবং এতে ভাইরাসের নিজস্ব প্রোটিনও অংশগ্রহণ করে থাকে।

ভাইরাসের কোষদেহে মোট তিন প্রকারের প্রোটিন থাকে, যথা:

১। গাঠনিক প্রোটিন (structural protein – SP): এরা ভাইরাসের কোষদেহের দৈহিক গঠনের মূল ভূমিকা পালন করে থাকে।

২। অগাঠনিক প্রোটিন (non-structural protein – NSP): এসব প্রোটিন ভাইরাসের মূল দৈহিক গঠনের কোনো ভূমিকা রাখে না, বরং এরা উৎসেচক এবং নানা কোষীয় নিয়ামক হিসেবে কাজ করে থাকে।

৩। সাহায্যকারী প্রোটিন (accessory protein): এসব প্রোটিন ভাইরাসের নানা গুরুত্বপূর্ণ শারীরবৃত্তীয় কাজে সাহায্য করে থাকে।

করোনা ভাইরাসের সম্পূর্ণ জিনোম এবং তা থেকে যেসব প্রোটিন উৎপন্ন হয়ে থাকে তার স্বল্পবিস্তার বর্ণনা নিচে এক এক করে দেওয়া হল।

রাইবোসোম

ORF1ab প্রোটিন-শিকল

করোনা ভাইরাসের জিনোম

ORF1ab  প্রোটিন আসলে একটি পলিপ্রোটিন অর্থাৎ অনেকগুলো প্রোটিনের একটি ধারাবাহিক শিকল। মোট ১৬ টি প্রোটিন এই শিকলে পরস্পর যুক্ত থাকে। পোষক দেহে জেনেটিক বস্তু প্রেরণের পর সর্বপ্রথম উৎপন্ন ভাইরাল প্রোটিন এটিই। এই পলিপ্রোটিনের মধ্যেই দুটি প্রোটিনই কাঁচি হিসেবে ভূমিকা পালন করে থাকে, যার ফলে বিভিন্ন প্রোটিনগুলোর মধ্যকার সংযোগ বিচ্ছিন্ন হয়ে তারা একেকটি স্বতন্ত্র প্রোটিন হিসেবে অবমুক্ত হয়। এরপরই প্রোটিনগুলো আলাদা আলাদাভাবে তাদের কাজ করতে আরম্ভ করে। 

করোনা ভাইরাসের উপর অজস্র গবেষণার ফলে বিজ্ঞানীগণ জানতে সক্ষম হয়েছেন যে করোনা ভাইরাসের কিছু প্রোটিন কি কি করতে পারে। কিন্তু এখনও এই ভাইরাসের অনেক প্রোটিনের কাজ সম্পর্কে অনেক কিছুই বিজ্ঞানী এবং আমাদের কাছে অজানাই রয়ে গেছে। হয়তো বা সেসব অজানা প্রোটিনগুলো নানা রহস্যময় কাজ করতে সক্ষম নয়তোবা এদের তেমন কোনো গুরুত্বপূর্ণ কাজ নেই।

NSP1 কোষীয় অন্তর্ঘাতক

NSP1 প্রোটিন

এটি ORF1ab পলিপ্রোটিনের প্রথম প্রোটিন, যা NSP1 নামে চিহ্নিত।এই প্রোটিনটি একটি ঘাতক প্রোটিন। কারণ এটি পোষক কোষের নিজস্ব প্রোটিন উৎপাদনকারী যন্ত্রগুলোকে অনেকটা কর্মাক্ষম করে দেয়। এতে পোষক প্রোটিন উৎপাদন ব্যহত হয় এবং জীবের অন্যান্য কোষীয় কার্যক্রমসমূহের সমন্বয়ও ব্যহত হয়। শুধু তাই নয়, এই প্রোটিনটি পোষক যন্ত্রকে অনেকটা বাধ্য করে ভাইরাল প্রোটিন উৎপাদনের কাজে ব্যবহার করে থাকে। সাথে সাথে এটি পোষক কোষে ভাইরাস বিরোধী কোনো প্রোটিন যা উক্ত ভাইরাসকে নিষ্ক্রিয় করে দিতে সক্ষম, সেসব প্রোটিনের কার্যকর বিন্যাস আটকে রাখতে কাজ করে থাকে।

NSP2 – রহস্যময় প্রোটিন

NSP2 প্রোটিন

NSP2 প্রোটিনের আসল কাজ সম্পর্কে বিজ্ঞানীরা এখনও নিশ্চিত নন। অর্থাৎ এখনও এই প্রোটিনের কাজ বিজ্ঞানীদের কাছে রহস্যই থেকে গেছে। বরং এই প্রোটিনটি অন্যান্য যে প্রোটিনের সাথে যুক্ত হয়ে কাজ করে, তা থেকে হয়তো এর কাজ সম্পর্কে কোনো ধারণা পাওয়া সম্ভব হবে। এদের মধ্যে দুইটি কোষে এন্ডোসোম নামক অণু বহনকারী বুদবুদসদৃশ গঠনের চলাচলে সহায়তা করে। 

NSP3 – ট্যাগদূরীকরণ ও কর্তনকারী

NSP3 প্রোটিন

NSP3 তুলনামূলক বৃহৎ আকারের প্রোটিন। এই প্রোটিনটির দুটি গুরুত্বপূর্ণ কাজ রয়েছে। তাদের মধ্যে একটি কাজ হচ্ছে ভাইরাসের পলিপ্রোটিন শিকল থেকে কেটে অন্যান্য প্রোটিনকে মুক্ত করা যাতে তারা তাদের কাজ সুষ্ঠুভাবে করতে পারে। অন্যটি হচ্ছে, পোষক কোষের প্রোটিনের বিভিন্ন ট্যাগকে সরিয়ে দেওয়া।

সাধারণত, সুস্থ ও সজীব কোষ তার পুরনো কোষীয় প্রোটিনে ট্যাগ লাগিয়ে রাখে, যাতে করে পরবর্তীতে সেসব পুরনো প্রোটিনকে ভেঙে তার থেকে অ্যামিনো এসিডগুলো নতুন প্রোটিন উৎপন্ন করতে পারে। কিন্তু করোনা ভাইরাসের এই NSP3 প্রোটিন পোষক কোষের সেসব প্রোটিন থেকে উক্ত ট্যাগ সরিয়ে দিয়ে কোষের এই স্বাভাবিক কাজে ব্যঘাত সৃষ্টি করে। ফলে কোষে একটি ভারসাম্যহীন অবস্থার সৃষ্টি হয়। এতে করে পোষক কোষের ভাইরাসের বিরুদ্ধে লড়াই করার জন্য কার্যকারিতা হ্রাস পায়।

NSP4 বুদবুদ উৎপন্নকারী

NSP4 প্রোটিন

NSP4 প্রোটিন অন্যান্য প্রোটিনের সাথে সংযুক্ত হয়ে আক্রান্ত পোষক কোষে তরল-পূর্ণ বুদবুদ উৎপন্ন করে। এইসব বুদবুদের অভ্যন্তরে নতুন ভাইরাসের আংশিক প্রতিলিপি তৈরি হয়ে থাকে।

NSP5 প্রোটিন-কাঁচি

NSP5 প্রোটিন

NSP5 প্রোটিন ORF1ab পলিপ্রোটিনের শেকলের অধিকাংশ জায়গায় কর্তন করে অন্যান্য ভাইরাল প্রোটিনকে অবমুক্ত করে। ফলস্বরূপ, প্রোটিনগুলো স্বতন্ত্র‍্যভাবে তাদের কাজ করতে সক্ষম হয়। 

NSP6 বুদবুদ কারখানা

NSP6 প্রোটিন

NSP6 প্রোটিন NSP3 ও NSP4 প্রোটিনদ্বয়ের সাথে কাজ করে ভাইরাসের আরও ছোট ছোট বুদবুদ কারখানা উৎপন্ন করে। 

NSP7 and NSP8 প্রতিলিপি সহায়ক

NSP7 প্রোটিন
NSP8 প্রোটিন

এই NSP7 ও NSP8 প্রোটিন দুটি NSP12 প্রোটিনকে নতুন করোনা ভাইরাসের আরএনএ জিনোমের প্রতিলিপি তৈরিতে সাহায্য করে। এই নতুন উৎপন্ন একসূত্রক আরএনএ অণুগুলো শেষ পর্যন্ত একেকটি নতুন ভাইরাসে পরিণত হয়।

NSP9 কোষের হৃদয়ে হানে যে

NSP9 প্রোটিন

আমাদের কোষের যাবতীয় গুরুত্বপূর্ণ তথ্য জমা থাকে আমাদের ডিএনএ-তে। এই ডিএনএ থাকে আমাদের কোষের প্রাণকেন্দ্র নিউক্লিয়াসে।

করোনা ভাইরাসের এই প্রোটিনটি মানুষের দেহের আক্রান্ত কোষের নিউক্লিয়াসে ক্ষুদ্র ক্ষুদ্র ছিদ্রের সৃষ্টি করে। যদিও আক্রান্ত কোষে এর প্রকৃত ভূমিকা সম্পর্কে এখনও কোনো স্পষ্ট কিছু জানা যায়নি, তবে ধারণা করা হয় যে এটি নিউক্লিয়াসে সৃষ্ট ক্ষুদ্র ছিদ্রের মধ্য দিয়ে নানা কোষীয় অণুর চলাচলকে প্রভাবিত করে।

NSP10 জেনেটিক ছদ্মবেশ

NSP10 প্রোটিন

মানুষের কোষে কিছু অ্যান্টিভাইরাল প্রোটিন রয়েছে যা কোষে ভাইরাল প্রোটিনের উপস্থিতি সনাক্ত করতে পারে এবং তাদেরকে ভেঙে টুকরো টুকরো করতেও সক্ষম। তবে এই NSP10 প্রোটিন অন্য আরেকটি ভাইরাল প্রোটিন NSP16 এর সাথে মিলে ভাইরাল প্রোটিনগুলোকে এক ছদ্মবেশ রূপ দেয় যাতে করে ভাইরাল প্রোটিন মানুষের কোষস্থ অ্যান্টিভাইরাল প্রোটিনের আক্রমণ থেকে বেঁচে যায়।

NSP12 প্রতিলিপি যন্ত্র

NSP12 প্রোটিন

এই প্রোটিনটি কোষের জেনেটিক অক্ষর (অ্যাডিনিন, গুয়ানিন, সাইটোসিন এবং ইউরাসিল) বা নিউক্লিওটাইডগুলোকে সাজিয়ে একটি নতুন ভাইরাল জিনোমে রুপান্তর করতে পারে। গবেষণায় দেখা গেছে যে রেমডিসিভির ( remdesivir) নামক অ্যান্টিভাইরাল ওষুধটি অন্যান্য করোনা ভাইরাসের NSP12 প্রোটিনের কাজে ব্যাঘাত সৃষ্টি করতে সক্ষম। ফলে বিজ্ঞানীরা এখনও চেষ্টা করে যাচ্ছেন এটা জানার জন্য যে এই ফলাফল কোভিড-১৯ এর বিরুদ্ধে কার্যকর কিনা।

আরেকটি প্রোটিন NSP11, NSP12 এর সাথে একই আরএনএ ক্রম বরাবর সমাপতিত। কিন্তু এই ছোট প্রোটিনটির কাজ সম্পর্কে এখন পর্যন্ত কোনো ধারণা করা সম্ভব হয়নি।

NSP13 আরএনএ-র জট খোলা

NSP13 প্রোটিন

স্বাভাবিক এবং অন্যান্য জিনোমের মতই করোনা ভাইরাসের আরএনএ খুব জটিলভাবে পাকানো ও প্যাঁচানো অবস্থাতেই থাকে। তবে এর প্রতিলিপি তৈরি করতে গেলে, এর জেনেটিক কোড থেকে প্রোটিন সংশ্লেষণ করতে গেলে একে নানা সাহায্যকারী প্রোটিন দ্বারা স্ক্যান করার প্রয়োজন হয়। তাই একে এর দুর্জ্ঞেয় প্যাঁচানো অবস্থা থেকে সরল সোজা সূত্রকের ন্যায় অবস্থায় উপনীত হতে হয়। বিজ্ঞানীরা ধারণা করছেন যে এই কাজটি করার জন্য NSP13 প্রোটিনটি সরাসরি ভূমিকা পালন করে, যাতে করে পরবর্তীতে ভাইরাসটির জিনোম পড়তে এবং এর থেকে প্রোটিন সংশ্লেষ করতে সুবিধা হয়।

NSP14 ভাইরাসের মুদ্রণসংশোধক

NSP14 প্রোটিন

NSP12  যখন ভাইরাসটির জিনোমের একটি হুবহু প্রতিলিপি তৈরি করে তখন মাঝে মধ্যে একটি দুটি জেনেটিক অক্ষর ভুলক্রমে ওলটপালট হয়ে যায়। NSP14 প্রোটিন তখন এই ত্রুটিপূর্ণ জেনেটিক অক্ষরগুলোকে সরিয়ে দেয় যাতে করে ঐ ভুল অক্ষরের পরিবর্তে সঠিক অক্ষরটি সঠিক জায়গামত বসতে পারে।

NSP15 – সব করে দেয় সাফ

NSP15 প্রোটিন

গবেষকদের ধারণা যে, আক্রান্ত কোষে ভাইরাল আরএনএ-র বিরুদ্ধে অ্যান্টিভাইরাল প্রতিরক্ষা ব্যবস্থা যেন গড়ে উঠতে না পারে সেজন্য এই প্রোটিনটি অতিরিক্ত বা অব্যবহার্য ভাইরাল আরএনএ-কে ভেঙে ছোট ছোট টুকরোতে পরিণত করে।

NSP16 আরও ছদ্মবেশ ও ধোঁকা

NSP16 প্রোটিন

পোষক কোষের অনাক্রম্য ব্যবস্থার যেসব প্রোটিন আগন্তুক ভাইরাল আরএনএ-কে ধ্বংস করে দেওয়ার ক্ষমতা রাখে, সেসব প্রোটিন থেকে ভাইরাল আরএনএ-কে রক্ষা করতে NSP16 ভাইরাল প্রোটিনটি NSP10 প্রোটিনের সাথে একত্রে কাজ করে।

S স্পাইক/কাঁটাসদৃশ প্রোটিন

করোনা ভাইরাসের চারটি গাঠনিক প্রোটিন রয়েছে। এরা হল – S, E, M এবং N  প্রোটিন। এরা ভাইরাসের কোষদেহের গঠনে সরাসরি অংশগ্রহণ করে। স্পাইক প্রোটিন হচ্ছে এই চারটির মধ্যে একটি গুরুত্বপূর্ণ গাঠনিক প্রোটিন। প্রোটিনটি করোনা ভাইরাসের কোষদেহের বহিঃস্থ স্তর গঠন করে এর অভ্যন্তরে আরএনএ তথা এর জিনোমকে সুরক্ষিত রাখে। ভাইরাসের গাঠনিক প্রোটিনগুলো আক্রান্ত কোষে উৎপন্ন ভাইরাল প্রোটিনের বিন্যাস এবং আক্রান্ত কোষ থেকে অপত্য ভাইরাসের বিমুক্তকরণে সাহয্য করে থাকে।

S প্রোটিন ভাইরাসের সর্ববহিঃস্থ স্তরে বা এর বহির্ভাগে লক্ষণীয় এবং বৈশিষ্ট্যসূচক কাঁটার মত একপ্রকার দৃশ্যমান তীক্ষ্ণ গঠন তৈরি করে। এই কাঁটাসদৃশ গঠন তিনটি তিনটি করে একেকটি দল তৈরি করে করোনা ভাইরাসের পুরো বহিঃস্থ স্তর জুড়ে অবস্থান করে। এই বৈশিষ্ট্যসূচক গঠনের জন্যই এর এরূপ নামকরণ হয়েছে।

এই কাঁটাসদৃশ গঠনের একটি অংশ বর্ধিত হয়ে ACE2 নামক প্রোটিনের সাথে গিয়ে সংযুক্ত হতে পারে। ACE2 প্রোটিন মানুষের শ্বাসতন্ত্রের একপ্রকার নির্দিষ্ট কোষের উপরিভাগে দেখা যায়, যা মূলত একটি রিসেপ্টর। এই রিসেপ্টরে করোনাভাইরাস তার সংযুক্তির মাধ্যমেই একটি কোষকে আক্রমণ করে।

SARS-CoV-2 এর স্পাইক প্রোটিনের যা জিন রয়েছে তাতে একটি মিউটেশন রয়েছে। এই মিউটেশনটি একটি প্রবিষ্ট পরিব্যক্তি (insertion mutation) এবং এতে ১২ টি জেনেটিক অক্ষর রয়েছেঃ ccucggcgggca, যা বাদুর বা আরও অন্যান্য প্রজাতিকে আক্রমণকারী করোনা ভাইরাসে অনুপস্থিত। এই বিবর্তনিক মিউটেশনের জন্যই হয়তো স্পাইক প্রোটিন মানুষের কোষের সাথে দৃঢ়ভাবে সংযুক্ত হতে পারে।

বর্তমান বিশ্বজুড়ে বিজ্ঞানীরা ভ্যাক্সিন তৈরির জন্য অক্লান্ত পরিশ্রম করে যাচ্ছেন। করোনার বিরুদ্ধে ভ্যাক্সিন উৎপাদনের প্রধান লক্ষ্যই হচ্ছে স্পাইক প্রোটিনকে মানুষের কোষের সাথে সংযুক্ত হওয়া রোধ করা।

ORF3a পালানোয় ওস্তাদ

ORF3a প্রোটিন

SARS-CoV-2 ভাইরাসের জিনোম প্রধান ও গাঠনিক প্রোটিন উৎপাদনের পাশাপাশি কিছু সাহায্যকারী প্রোটিনও (accessory proteins) উৎপন্ন করে থাকে। এসব প্রোটিনের কাজ হল আক্রান্ত কোষে এমন এক উপযোগী পরিবেশ তৈরি করা যাতে তা ভাইরাসের সংখ্যা বৃদ্ধির সহায়ক হয়।

অপত্য ভাইরাসের প্রতিলিপি গঠন ও সম্পন্ন করার পর ORF3a  প্রোটিন আক্রান্ত কোষের প্লাজমা মেমব্রেন বা বহিঃস্থ ঝিল্লী ছিদ্র করে তাদেরকে বের হতে পথ করে দেয়। এটি একই সাথে প্রদাহেরও সূচনা করে। যার ফলে ক্ষতিগ্রস্থ হয় কোষ এবং শুরু হয় শ্বাসকষ্টের এবং এটি কোভিড-১৯ রোগের সবচেয়ে ভয়াবহ উপসর্গ।

ORF3b  জিন ORF3a এর উপর সমাপতিত হয়। কিন্তু বিজ্ঞানীরা এখনও নিশ্চিত নন যে SARS-CoV-2 ভাইরাস কোনো প্রোটিন উতপন্নের জন্য এই জিনটির ব্যবহার করে থাকে।

E মোড়ক প্রোটিন

E প্রোটিন

এনভেলপ প্রোটিন বা মোড়ক প্রোটিন ভাইরাসের এক প্রকার গাঠনিক প্রোটিন যা লিপিডের সাথে মিলে একটি যৌগিক গঠন তৈরি করে। লিপিড স্নেহ অর্থাৎ তৈলজাতীয় পদার্থ। মূলতঃ এনভেলপ প্রোটিন ভাইরাসকে একটি তেলের বুদবুদ সদৃশ অণুতে পরিণত করে। মনে করা হয়ে থাকে যে যখন ভাইরাস কোনো কোষকে আক্রমণ করে এর অভ্যন্তরে প্রবেশ করে তখন সে আক্রান্ত কোষের তথা আমাদের বিভিন্ন জিনকে নিয়ন্ত্রণ করে থাকে। জিনের নিয়ন্ত্রণের ব্যাপারে বলতে মূলতঃ জিনকে চালু ও বন্ধ করাকে বুঝায়। যখন কোনো জিন থেকে প্রোটিন সংশ্লেষণ হয় তখন সেই জিনটির কাজ চালু আছে বলা হয়। আর যখন কোনো জিন থেকে প্রোটিন উৎপন্ন হতে পারে না, তখন সেটি বন্ধ আছে বলা হয়।

M ঝিল্লী প্রোটিন

M প্রোটিন

এটিও একটি গাঠনিক প্রোটিন যা ভাইরাসের কোষদেহের বহিরাবরণের ঝিল্লী বা পর্দা গঠন করে।

ORF6 ট্রাফিক সঙ্কেত

ORF6 প্রোটিন

আমাদের দেহে যখন কোনো ভাইরাস বা অন্যান্য অণুজীব আক্রমণ করে তখন স্বয়ংক্রিয়ভাবে আমাদের দেহের প্রতিরক্ষা ব্যবস্থার কাছে এই অনাকাঙ্ক্ষিত আক্রমণের সংভাদ পৌঁছে যায়। এই সংবাদ বা সংকেত যাতে আমাদের প্রতিরক্ষা ব্যবস্থার নিকট দ্রুত পৌঁছাতে পারে, এর জন্য নানা নিয়ামক কাজ করে থাকে।

করোনা ভাইরাসের ORF6 প্রোটিনের কাজই হচ্ছে এই সংকেত পৌঁছানোর সকল পথ বন্ধ করে দেওয়া। শুধুই তাই নয়, এই প্রোটিনটি আমাদের কোষস্থ অ্যান্টিভাইরাল প্রোটিনগুলোকেও নিষ্ক্রিয় করে দেয়। ফলে আমাদের প্রতিরক্ষাকারী প্রোটিনগুলো ভাইরাল প্রোটিনের বিরুদ্ধে কোনো ভূমিকা পালন করতে পারে না। এই একই কাজ পোলিও ভাইরাস এবং ইনফ্লুয়েঞ্জা ভাইরাসও করে থাকে।  

ORF7a ভাইরাস অবমুক্তকারী

ORF7a প্রোটিন

আক্রান্ত কোষে উৎপন্ন অপত্য ভাইরাসগুলো যখন পোষক কোষ থেকে বের হতে যায়, তখন টেথেরিন (tetherin)নামক প্রোটিন ফাঁদের মত অবস্থার সৃষ্টি করে ভাইরাসের অবমুক্তিতে ব্যঘাত ঘটায়। কয়েকজন গবেষক ধারণা করছেন যে ORF7a প্রোটিন পোষক কোষে টেথেরিন উতপন্নের সকল পথ বন্ধ করে দেয়। এতে করে আক্রান্ত কোষ ভেদ করে অপত্য ভাইরাসগুলো সহজেই অবমুক্ত হতে পারে।

একই সাথে গবেষকগণ এটাও বুঝতে পেরেছেন যে এই ORF7a প্রোটিন আক্রান্ত কোষকে আত্মহত্যার পথে ঠেলে দেয়। ঠিক এই অবস্থারই সৃষ্টি হয় যখন কোভিড-১৯ রোগের কারণে ফুসফুসের কোষগুলো তথা ফুসফুসের ক্ষতিসাধন হয়।

ORF3b এর মত ORF7b-ও ORF7a জিনের উপর সমাপতিত, কিন্তু এটি এখনও পরিষ্কার নয় যে এই প্রোটিনের কাজ আসলে কী।

ORF8 – আরও একটি রহস্যময় প্রোটিন

ORF8 প্রোটিন

SARS-CoV-2 ভাইরাসে ORF8 জিন থেকে উৎপন্ন সাহায্যকারী প্রোটিনটি অন্যান্য করোনা ভাইরাসের প্রোটিন থেকে নাটকীয়ভাবে ভিন্ন। গবেষকগণ এখনও এই প্রোটিনের আসল কাজ সম্পর্কে সন্দিহান।

N নিউক্লিওক্যাপসিড প্রোটিন

N প্রোটিন

নিউক্লিওক্যাপসিড প্রকৃত কোষের নিউক্লিয়ার মেমব্রেনের মত কাজ করে। মূলতঃ ভাইরাল আরএনএ-কে ভাইরাস কোষদেহে সুরক্ষিত রাখার দায়িত্বটি এই প্রোটিন পালন করে। অনেকগুলো N প্রোটিন পরস্পরের সাথে সংযুক্ত হয়ে একটি দীর্ঘ সর্পিল গঠন তৈরি করে। এই সর্পিল গঠনটি ভাইরাল আরএনএ কে সম্পূর্ণ আচ্ছাদিত করে রাখে।

একই জিন বরাবর ORF9b ও ORF9c সাহায্যকারী প্রোটিনের জিন দুটিও সমাপতিত। ORF9b প্রোটিন পোষক কোষের ইন্টারফেরনকে বাঁধাদান করে। ইন্টারফেরন আমাদের কোষের অনেকগুলো প্রতিরক্ষামূলক অণুর একটি, যা আমাদেরকে ভাইরাসের আক্রমণ থেকে সুরক্ষা প্রদান করে। এর মূল কার্যপদ্ধতি অনেক জটিল এবং সুনির্দিষ্ট। অপরদিকে, বিজ্ঞানীরা এখনও পরিষ্কার নন যে ORF9c প্রোটিন আসলেই কোনো কাজ করে কিনা।

ORF10 – এবং আরও একটি রহস্যময় প্রোটিন

ORF10 প্রোটিন

ORF10 জিন শুধুমাত্র সার্স কোভিড-২ ভাইরাসেই পাওয়া গেছে, যা অন্যান্য করোনা ভাইরাসে সম্পূর্ণ অনুপস্থিত। তাই এখন পর্যন্ত বিজ্ঞানী ও গবেষকদের কেউই এই জিনের কাজ সম্বন্ধে নিশ্চিত নন। এমনকি এই জিন থেকে কোনো প্রোটিন উৎপন্ন হয় কি না – তা নিয়েও রয়েছে ধোঁয়াশা। 

 সারির শেষতক

ভাইরাল আরএনএ

এতক্ষণ আমরা জিনোমের শুরু থেকে একাধারে এক এক করে প্রতিটা জিন সম্পর্কে জানতে জানতে এসেছি। এই পর্যায়ে আমরা এর জিনোমের একেবারে শেষপ্রান্তে এসে পৌঁছে গেছি। জিনোমের এই শেষপ্রান্তে এসে প্রোটিন উৎপন্নকারী যে সহায়ক কোষীয় যন্ত্রগুলো রয়েছে সেগুলোও থেমে যায়। জিনোম বা আরএনএ-র এই অংশটি একটি পৌনঃপুনিক সিকুয়েন্স বহন করে, সেটি হলঃ aaaaaaaaaaaaa

তথ্যসূত্রঃ https://www.nytimes.com/interactive/2020/04/03/science/coronavirus-genome-bad-news-wrapped-in-protein.html

আপনার মতামত লিখুন :

ট্যাগ
Back to top button
Close